EL EJERCITO DE LA VERDAD

EJERCITO DE LA VERDAD

Nace un nuevo grupo desarmado que revolucionara en Colombia, se autodenomina EL EJERCITO DE LA VERDAD detalles a continuación :

Recibo un comentario en SELENA SPICE O ANDREA RINCÓN EN TELEVISIÓN, con el nick el EJERCITO DE LA VERDAD y me lleva a un enlace sobre un blog titulado LA VERDAD SOBRE ANDREA RINCÓN. Esta es otra forma de hacer blogs la cual no conocían en Colombia pero igualmente es valida, en su contenido hablan de como esta niña que sigue teniendo una gran popularidad en los blogs e Internet, no dice la verdad, pues según fotos publicadas en el blog la niña era muy normalita y de un momento a otro saltaron miles de atributos……

Los blogs definitivamente son de libre expresión y este grupo autodenominado EJERCITO DE LA VERDAD, al parecer se dedicara a desenmascarar…….

.

  • principe

    y la ubicacion de esas fotos cual es

  • http://www.laverdadsobreandrearincon.blogspot.com el ultra ejercito de la verdad

    vean unas foticos nuevas de esta bastarda en http://www.laverdadsobreandrearincon.blogspot.com

    ATTE. EL ULTRA EJERCITO DE LA VERDAD

    PD. MANDENOS FOTICOS DE ESTAs PERRUCHAs A elejercito_delaverdad@hotmail.com

  • http://wwwss.laverdadsobreandrearincon.blogspot.com el ultra ejercito de la verdad

    comentario moderadopor resultar ofensivo

  • el ultra ejercito de la verdad

    COMENTARIO MODERADO

  • http://hotmail aleja

    A PRINCIPE QUE ME DE SU MAIL PARA MANDARLE LAS FOTOS Q QUIERE DE LUISA,LE TENGO UNAS FOTOS MUY BUENAS.PARA QITARLE LA CURIOSIDAD.

  • http://hotmail aleja

    COMO PARA NO QUEDARSE ATRAS YA LA LUISA LLEVA EL PRIMER LUGAR DE PREPAGO EN CALI Y PARA COLMO QUITA NOVIOS ,LA MUY PERRA Y ASTUTA NIÑA LE QUITO EL NOVIO A ANDREITA RINCON,SU GRAN AMIGA Y COLEGA,MEJOR DICHO HASTA DONDE LLEGA LA AVARICIA DE ESTA MUJER SIN ESCRUPULOS Q NO LE INTERESA PASAR POR ENCIMA DE NADIE SOLO POR CONSEGUIR SUS INTERESES MATERIALES,YA LE SACO EL JUGO A HUMBERTO,EL PASTUZO,JUNIOR,GEOVANY VARGAS,OTROS MAS Y AHORA VA HA ACABAR CON FITO,NO HAY DERECHO MUCHACHOS Q SE DEJEN UTILIZAR Y ENGAÑAR POR ESTA MAQUINA REGISTRADORA HASTA CUANDO.

  • Principe

    Completamente de acuerdo con los comentarios de Pata E’ Perro. Cada uno que haga con su vida lo que su entendimiento le diga. Yo he visto a Andrea a través de la red desde hace como un año y simplemente me parece espectacular.

    La misma historia la he visto en otros blogs contra Laura Acuña. En realidad no se que le hicieron estas mujeres a las personas que les escriben mal. Pero para mi que cada uno viva su vida y no sufra por otros.

    por ultimo, le agradezco mucho al ejercito de la verdad por su blog de la verdad de Andrea. es la mejor recopilación de fotos y videos de la niña que andaba buscando hace rato. A Alejandra, Carolina y Angie, por favor publiquen fotos de luisa F Bedoya que ya me despertaron la curiosidad no friegue.

  • Pata e´ perro

    Queridos amigos de cafeguauguau, me permito ladrar lo siguiente:

    Desde hace muy poco y por casualidad en una revista observé dos fotografías de Andrea Rincón, lo cual me llevó a querer saber un poco más de esta ( a pesar de todos sus comentarios) indiscutble atractiva mujer. Sin embargo, en mis navegaciones averiguatorias en la red, me encontré con un sinfín de comentarios, imágenes y videos que muestran a esta caleña no solo como una modelo sino como una hembra que desempeña otros menestéres de nula cuantía moral. Mi pregunta es: Por qué tanto enzañamiento hacia esta mujer? Qué es lo que ella ha hecho y que otras mujeres modelos no, para que en algunas páginas de internet le den tan duro?

    La impresión que Andrea rincón (o Selena Spice como me enteré ayer que también la llamaba)me da es la de ser una mujer como muchas otras de ahora, gustosa de ganarse la vida sin el beneficio del intelecto, con su puro físico; y todavía por su edad y seguramente por el medio frívolo del modelaje en el que se mueve sin una estructura mental o personalidad atractiva.

    De todas formas no se le niega que como mujer a demás de reflejar un toque grotezco en sus fotografías si logra ser admirada por su cuerpazo.

    GGGUUUUUUUUUUAAAAAAAAUUUUUU!!!!

    gracias cafeguauguau.

  • angie

    la 2 prepago camuflada despues de andrea rincon es luisa bedoya,claro que solo se comen a los traketos de moda,humberto,geovany,junior,cristian,el pastuzo etc,a eso si son las mas santas de cali,no hacen si no venderse en los eventos de car audio y los desfiles,y en las discotekas las encuentra uno todas drogadas con pepas y poper.ja que pesar me da con los manes q salen con la bedoya,deberian hacerse un examen para saber si tienen alguna enfermedad,esta niña luisa es muy promiscua.hata la proxima y saquen alguna foto de la famosa luisa.

  • http://www.laverdadsobreandrearincon.blogspot.com el ejercito de la verdad

    En el encabezado dice que la niña que aparece en el blog http://www.laverdadsobreandrearincon.blogspot.com si es ella¡¡¡¡ solo miren bien sus rasgos y facciones de la cara y se daran cuenta que se hizo un cambio extremo culo, tetas, liposuccion con abdominoplastia, rinoplastia y diseño de sonrisa.(registros fotograficos de archivo veridicos. ya las paginas donde las sacamos no existen)
    esta bien que se haga la de frankestein y realmente mujer fea no hay sino marido pobre.
    a esa luisa fda bedoya solo viendole la cara se le hace el sumario que es otra protituta mas disfrazada de modelo. El modelaje en si. es solo una disculpa mas para protituirse. ya le sacaremos los cueritos al sol a esta ramera que se hace llamar isabella. y cuantas mas que se camuflan con el modelaje.
    realmente ustedes piensan en darle credibilidad a una prepago o ramera que constantemente se esta contradiciendo en cuanta salida o entrevista. se tiene que ser demasiado INGENUO para creerle una Vagabunda de estas. la mujerzuela esta ya NO tiene argumentos para defenderse. su final es facil de saber.
    la pornografia¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡ la que dice continuamente que no hace. se le nota lo bruta e ignorante que es.
    Vean la verdad de esta sucia con la panocha tripuda en:
    http://www.laverdadsobreandrearincon.blogspot.com

    el ultra ejercito de la verdad

    PD: Verdad se escribe con V de Victoria.

  • alejandra

    quiero al igual q carolina le quiten la mascara a luisa bedoya,la muy perra se las da muy santa y tambien es una prepago o si no preguntelen a mas de un traqueto q hay en cali,como a quique, mauricio,humberto y geovany.

  • carolina

    mostrar las fotos que retiraron del internet de luisa fernanda bedoya las mismas que se tomo junto a andrea rincon o hablar acerca de esto.se las quire dar de muy santa

  • carolina

    deberian desemmascarar a luisa fernanda bedoya amiguisima y colega de andrea rincon.

  • http://www.lacoctelera.com/saboracensura Bilioso

    Yo no escribí el comentario anterior.

  • http://www.lacoctelera.com/saboracensura bilioso

    señores, los voy a enlazar en mi blog. Este sitio esta muy bueno.